Metadata-Version: 1.1
Name: cruzdb
Version: 0.5.1
Summary: Interface to UCSC genomic databases.
Also allows things like up/downstream/k-nearest-neighbor queries and mirroring
of tables to local sqlite databases
Home-page: https://github.com/brentp/cruzdb/
Author: Brent Pedersen
Author-email: bpederse@gmail.com
License: UNKNOWN
Description: A rendered version of the docs is available at: http://pythonhosted.org/cruzdb/
        
        A paper describing cruzdb is in Bioinformatics: http://bioinformatics.oxfordjournals.org/cgi/content/abstract/btt534?ijkey=9I8rQeolKOhzFHv&keytype=ref
        
        cruzdb overview
        ===============
        
        The UCSC `Genomes Database`_ is a great resource for annoations, regulation
        and variation and all kinds of data for a growing number of taxa.
        This library aims to make utilizing that data simple so that we can do
        sophisticated analyses without resorting to `awk-ful`_, error-prone
        manipulations.
        As motivation, here's an example of some of the capabilities::
        
            >>> from cruzdb import Genome
        
            >>> g = Genome(db="hg18")
        
            >>> muc5b = g.refGene.filter_by(name2="MUC5B").first()
            >>> muc5b
            refGene(chr11:MUC5B:1200870-1239982)
        
            >>> muc5b.strand
            '+'
        
            # the first 4 introns
            >>> muc5b.introns[:4]
            [(1200999L, 1203486L), (1203543L, 1204010L), (1204082L, 1204420L), (1204682L, 1204836L)]
        
            # the first 4 exons.
            >>> muc5b.exons[:4]
            [(1200870L, 1200999L), (1203486L, 1203543L), (1204010L, 1204082L), (1204420L, 1204682L)]
        
            # note that some of these are not coding because they are < cdsStart
            >>> muc5b.cdsStart
            1200929L
        
            # the extent of the 5' utr.
            >>> muc5b.utr5
            (1200870L, 1200929L)
        
            # we can get the (first 4) actual CDS's with:
            >>> muc5b.cds[:4]
            [(1200929L, 1200999L), (1203486L, 1203543L), (1204010L, 1204082L), (1204420L, 1204682L)]
        
            # the cds sequence from the UCSC DAS server as a list with one entry per cds
            >>> muc5b.cds_sequence #doctest: +ELLIPSIS
            ['atgggtgccccgagcgcgtgccggacgctggtgttggctctggcggccatgctcgtggtgccgcaggcag', ...]
        
        
            >>> transcript = g.knownGene.filter_by(name="uc001aaa.2").first()
            >>> transcript.is_coding
            False
        
            # convert a genome coordinate to a local coordinate.
            >>> transcript.localize(transcript.txStart)
            0L
        
            # or localize to the CDNA position.
            >>> print transcript.localize(transcript.cdsStart, cdna=True)
            None
        
        DataFrames
        ----------
        ... are so in. We can get one from a table as::
        
           >>> df = g.dataframe('knownGene', limit=20) 
           >>> df.columns #doctest: +ELLIPSIS
           Index([name, chrom, strand, txStart, txEnd, cdsStart, cdsEnd, exonCount, exonStarts, exonEnds, proteinID, alignID], dtype=object)
        
        
        
        All of the above can be repeated using knownGene annotations by changing 'refGene' to 
        'knownGene'. And, it can be done easily for a set of genes.
        
        Spatial
        -------
        
        k-nearest neighbors, upstream, and downstream searches are available.
        Up and downstream searches use the strand of the query feature to determine the direction:
        
            >>> nearest = g.knearest("refGene", "chr1", 9444, 9555, k=6)
            >>> up_list = g.upstream("refGene", "chr1", 9444, 9555, k=6)
            >>> down_list = g.downstream("refGene", "chr1", 9444, 9555, k=6)
        
        
        
        Mirror
        ------
        
        The above uses the mysql interface from UCSC. It is now possible to mirror
        any tables from UCSC to a local sqlite database via:
        
           # cleanup
        
           >>> import os
           >>> if os.path.exists("/tmp/u.db"): os.unlink('/tmp/u.db')
        
           >>> g = Genome('hg18')
        
        
        
           >>> gs = g.mirror(['chromInfo'], 'sqlite:////tmp/u.db')
        
        and then use as:
        
           >>> gs.chromInfo
           <class 'cruzdb.sqlsoup.chromInfo'>
        
        
        Code
        ----
        
        Most of the per-row features are implemented in `cruzdb/models.py` in the
        Feature class. If you want to add something to a feature (like the existing
        feature.utr5) add it here.
        
        The tables are reflected using `sqlalchemy`_ and mapped in the
        \_\_getattr\_\_\ method of the `Genome` class in `cruzdb/__init__.py`
        
        So a call like::
        
            genome.knownGene
        
        calls the \_\_getattr\_\_ method with the table arg set to 'knownGene'
        that table is then reflected and an object with parent classes of `Feature`
        and sqlalchemy's declarative_base is returned.
        
        
        Contributing
        ------------
        
        YES PLEASE!
        
        To start coding, it is probably polite to grab your own copy of some of the
        UCSC tables so as not to overload the UCSC server. 
        You can run something like::
        
           Genome('hg18').mirror(["refGene", "cpgIslandExt", "chromInfo", "knownGene", "kgXref"], "sqlite:////tmp/hg18.db")
        
        Then the connection would be something like::
        
            g = Genome("sqlite:////tmp/hg18.db")
        
        If you have a feature you like to use/implement, open a ticket on github for
        discussion. Below are some ideas.
        
        
        .. _`Genomes Database`: http://genome.ucsc.edu/cgi-bin/hgTables
        .. _`awk-ful`: https://gist.github.com/1173596
        .. _`sqlalchemy`: http://sqlalchemy.org/
        
Platform: UNKNOWN
Classifier: Development Status :: 4 - Beta
Classifier: Environment :: Console
Classifier: Intended Audience :: End Users/Desktop
Classifier: Intended Audience :: Developers
Classifier: Intended Audience :: System Administrators
Classifier: License :: OSI Approved :: MIT License
Classifier: Operating System :: MacOS :: MacOS X
Classifier: Operating System :: POSIX
Classifier: Topic :: Database
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Topic :: Scientific/Engineering :: Medical Science Apps.
