Metadata-Version: 1.0
Name: oldowan.mtconvert
Version: 1.0.0
Summary: Transform human mtDNA sequence to variant sites and vice versa.

Home-page: http://www.raaum.org
Author: Ryan Raaum
Author-email: code@raaum.org
License: MIT
Description: oldowan.mtconvert is a small, pure Python, bioinformatic utility to (1)
        transform human mitochondral DNA sequence data into variant sites relative to
        the revised Cambridge Reference Sequence (rCRS) and (2) transform variant sites
        data into DNA sequence. Further information on the rCRS and variant site
        nomenclature for human mtDNA sequences is available at the mtconvert_ website.
        
        Installation Instructions
        =========================
        
        This package is pure Python and has no dependencies outside of the standard
        library. The easist way to install is using ``easy_install`` from the
        setuptools_ package.  This usually goes something like this::
        
        $ easy_install oldowan.mtconvert
        
        or on a unix-like system, assuming you are installing to the main Python
        ``site-packages`` directory as a non-privileged user, this::
        
        $ sudo easy_install oldowan.mtconvert
        
        You may also use the standard python distutils setup method. Download the
        current source archive from the file list towards the bottom of this page,
        unarchive it, and install. On Mac OS X and many other unix-like systems, having
        downloaded the archive and changed to the directory containing this archive in
        your shell, this might go something like::
        
        $ tar xvzf oldowan.mtconvert*
        $ cd oldowan.mtconvert*
        $ python setup.py install
        
        Quick Start
        ===========
        
        Import ``seq2sites`` and ``sites2seq`` from oldowan.mtconvert::
        
        >>> from oldowan.mtconvert import seq2sites, sites2seq
        
        Convert sequence to sites::
        
        >>> seq = """TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAA
        GTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCC
        AGCCACCATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGT
        ACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCA
        AGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAG
        CCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGT
        ACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATC
        CCTTCTCGTCCC"""
        >>> seq2sites(seq)
        
        Sequences must be contiguous! Separate runs of sequence, such as HVR1 and HVR2
        without the intervening sequence interval, must be analyzed separately.
        
        There is also a cutoff on the number of ambigous sites (N) allowed in the
        sequence. By default, this is 10 - but this is an option that can be set::
        
        >>> seq2sites(seq, ambig_cutoff=20)
        
        Convert a list of variable sites to sequence. The default sequence region that
        is returned is hypervariable region 1 (HVR1), which is positions 16024 to 16365
        of the rCRS (in biological one-based numbering)::
        
        >>> sites2seq('16129A 16223T')
        
        Predefined sequence regions are:
        
        - HVR1: 16024-16365
        - HVR2: 73-340
        - HVR1to2: 16024-340
        - coding: 577-15992
        - all: 1-16559
        
        So, to convert a list of HVR2 sites to sequence::
        
        >>> sites2seq('73G', region='HVR2')
        
        Sites may also be provided in a list::
        
        >>> sites2seq(['16129A', '16223T', '73G'], region='HVR1to2')
        
        The rCRS sequence will be returned given an empty string, empty list, or the
        string 'rCRS'. All of the following are equivalent::
        
        >>> sites2seq('')
        >>> sites2seq([])
        >>> sites2seq('rCRS')
        
        Arbitrary positions may be selected by passing a list of sites to the
        ``region`` option::
        
        >>> sites2seq('', region=[1,2,3])
        
        The Python range function is convenient for this, but you must remember that
        the range does not include it's ending position::
        
        >>> sites2seq('', region=range(73,341))  # include 340, but not 341
        
        Release History ===============
        
        1.0.0 (March 25, 2009)
        initial release of module.
        
        .. _setuptools: http://peak.telecommunity.com/DevCenter/EasyInstall
        
Keywords: bioinformatics
Platform: Any
Classifier: Development Status :: 5 - Production/Stable
Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved :: MIT License
Classifier: Operating System :: OS Independent
Classifier: Programming Language :: Python
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
