Metadata-Version: 1.0
Name: pyfasta
Version: 0.3.7
Summary: fast, memory-efficient, pythonic (and command-line) access to fasta sequence files
Home-page: http://bitbucket.org/brentp/biostuff/
Author: brentp
Author-email: bpederse@gmail.com
License: MIT
Description: ==================================================
        pyfasta: pythonic access to fasta sequence files.
        ==================================================
        
        
        :Author: Brent Pedersen (brentp)
        :Email: bpederse@gmail.com
        :License: MIT
        
        .. contents ::
        
        Implementation
        ==============
        
        Requires Python >= 2.5. Stores a flattened version of the fasta file without
        spaces or headers and uses either a mmap of numpy binary format or fseek/fread so the
        *sequence data is never read into memory*. Saves a pickle (.gdx) of the start, stop
        (for fseek/mmap) locations of each header in the fasta file for internal use.
        
        Usage
        =====
        ::
        
        >>> from pyfasta import Fasta
        
        >>> f = Fasta('tests/data/three_chrs.fasta')
        >>> sorted(f.keys())
        ['chr1', 'chr2', 'chr3']
        
        >>> f['chr1']
        NpyFastaRecord(0..80)
        
        
        Slicing
        -------
        ::
        
        >>> f['chr1'][:10]
        'ACTGACTGAC'
        
        # get the 1st basepair in every codon (it's python yo)
        >>> f['chr1'][::3]
        'AGTCAGTCAGTCAGTCAGTCAGTCAGT'
        
        # can query by a 'feature' dictionary
        >>> f.sequence({'chr': 'chr1', 'start': 2, 'stop': 9})
        'CTGACTGA'
        
        # same as:
        >>> f['chr1'][1:9]
        'CTGACTGA'
        
        # with reverse complement (automatic for - strand)
        >>> f.sequence({'chr': 'chr1', 'start': 2, 'stop': 9, 'strand': '-'})
        'TCAGTCAG'
        
        Numpy
        =====
        
        The default is to use a memmaped numpy array as the backend. In which case it's possible to
        get back an array directly...
        ::
        
        >>> f['chr1'].tostring = False
        >>> f['chr1'][:10] # doctest: +NORMALIZE_WHITESPACE
        memmap(['A', 'C', 'T', 'G', 'A', 'C', 'T', 'G', 'A', 'C'], dtype='|S1')
        
        >>> import numpy as np
        >>> a = np.array(f['chr2'])
        >>> a.shape[0] == len(f['chr2'])
        True
        
        >>> a[10:14] # doctest: +NORMALIZE_WHITESPACE
        array(['A', 'A', 'A', 'A'], dtype='|S1')
        
        mask a sub-sequence
        ::
        
        >>> a[11:13] = np.array('N', dtype='c')
        >>> a[10:14].tostring()
        'ANNA'
        
        
        Backends (Record class)
        =======================
        It's also possible to specify another record class as the underlying work-horse
        for slicing and reading. Currently, there's just the default:
        
        * NpyFastaRecord which uses numpy memmap
        * FastaRecord, which uses using fseek/fread
        * MemoryRecord which reads everything into memory and must reparse the original
        fasta every time.
        * TCRecord which is identical to NpyFastaRecord except that it saves the index
        in a TokyoCabinet hash database, for cases when there are enough records that
        loading the entire index from a pickle into memory is unwise. (NOTE: that the
        sequence is not loaded into memory in either case).
        
        It's possible to specify the class used with the `record_class` kwarg to the `Fasta`
        constructor:
        ::
        
        >>> from pyfasta import FastaRecord # default is NpyFastaRecord
        >>> f = Fasta('tests/data/three_chrs.fasta', record_class=FastaRecord)
        >>> f['chr1']
        FastaRecord('tests/data/three_chrs.fasta.flat', 0..80)
        
        other than the repr, it should behave exactly like the Npy record class backend
        
        it's possible to create your own using a sub-class of FastaRecord. see the source
        in pyfasta/records.py for details.
        
        Flattening
        ==========
        In order to efficiently access the sequence content, pyfasta saves a separate, flattened file with all newlines and headers removed from the sequence. In the case of large fasta files, one may not wish to save 2 copies of a 5GG+ file. In that case, it's possible to flatten the file "inplace", keeping all the headers, and retaining the validity of the fasta file -- with the only change being that the new-lines are removed from each sequence. This can be specified via `flatten_inplace` = True
        ::
        
        >>> import os
        >>> os.unlink('tests/data/three_chrs.fasta.gdx') # cleanup non-inplace idx
        >>> f = Fasta('tests/data/three_chrs.fasta', flatten_inplace=True)
        >>> f['chr1']  # note the difference in the output from above.
        NpyFastaRecord(6..86)
        
        # sequence from is same as when requested from non-flat file above.
        >>> f['chr1'][1:9]
        'CTGACTGA'
        
        # the flattened file is kept as a place holder without the sequence data.
        >>> open('tests/data/three_chrs.fasta.flat').read()
        '@flattened@'
        
        
        Command Line Interface
        ======================
        there's also a command line interface to manipulate / view fasta files.
        the `pyfasta` executable is installed via setuptools, running it will show
        help text.
        
        split a fasta file into 6 new files of relatively even size:
        
        $ pyfasta **split** -n 6 original.fasta
        
        split the fasta file into one new file per header with "%(seqid)s" being filled into each filename.:
        
        $ pyfasta **split** --header "%(seqid)s.fasta" original.fasta
        
        create 1 new fasta file with the sequence split into 10K-mers:
        
        $ pyfasta **split** -n 1 -k 10000 original.fasta
        
        2 new fasta files with the sequence split into 10K-mers with 2K overlap:
        
        $ pyfasta **split** -n 2 -k 10000 -o 2000 original.fasta
        
        
        show some info about the file (and show gc content):
        
        $ pyfasta **info** --gc test/data/three_chrs.fasta
        
        
        **extract** sequence from the file. use the header flag to make
        a new fasta file. the args are a list of sequences to extract.
        
        $ pyfasta **extract** --header --fasta test/data/three_chrs.fasta seqa seqb seqc
        
        **extract** sequence from a file using a file containing the headers *not* wanted in the new file:
        
        $ pyfasta extract --header --fasta input.fasta --exclude --file seqids_to_exclude.txt
        
        
        **flatten** a file inplace, for faster later use by pyfasta, and without creating another copy. (`Flattening`_)
        
        $ pyfasta flatten input.fasta
        
        cleanup
        =======
        (though for real use these will remain for faster access)
        ::
        
        >>> os.unlink('tests/data/three_chrs.fasta.gdx')
        >>> os.unlink('tests/data/three_chrs.fasta.flat')
        
        Testing
        =======
        there is currently > 99% test coverage for the 2 modules and all included
        record classes. to run the tests:
        ::
        
        $ python setup.py nosetests
        
        Changes
        =======
        
        0.3.6/7
        -------
        * dont re-flatten the file every time!
        * allow spaces before and after the header in the orginal fasta.
        
        0.3.5
        -----
        
        * update docs in README.txt for new CLI stuff.
        * allow flattening inplace.
        * get rid of memmap (results in faster parsing).
        
        0.3.4
        -----
        
        * restore python2.5 compatiblity.
        * CLI: add ability to exclude sequence from extract
        * CLI: allow spliting based on header.
        
        0.3.3
        -----
        
        * include this file in the tar ball (thanks wen h.)
        
        0.3.2
        -----
        
        * separate out backends into records.py
        
        * use nosetests (python setup.py nosetests)
        
        * add a TCRecord backend for next-gen sequencing availabe if tc is (easy-)installed.
        
        * improve test coverage.
        
Keywords: bioinformatics blast fasta
Platform: UNKNOWN
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
