Linearize pYPKpw with EcoRV resulting in the linearized vector.
Carry out a PCR with primers 577, 567 and template pYPKa_Z_FBA1tp resulting in
the PCR product 861bp_PCR_prod
5GTTCTGATCCTCGAGCATCTTAAGAATTC...CTCACTAGTGACCTGCAGCCGAC3
||||||||||||||||||||||| tm 59.0 (dbd) 70.7
3gagtgatcactggacgtcggcTG5
5gttctgatcctcgagcatcttaagaattc3
||||||||||||||||||||||||||||| tm 56.1 (dbd) 69.4
3CAAGACTAGGAGCTCGTAGAATTCTTAAG...GAGTGATCACTGGACGTCGGCTG5
Taq (rate 30 nt/s)
Three-step| 30 cycles | |SantaLucia 1998
94.0°C |94.0°C | |SaltC 50mM
__________|_____ 72.0°C |72.0°C|
04min00s |30s \ ________|______|
| \ 56.0°C/ 0min25s|10min |
| \_____/ | |
| 30s | |4-8°C
Pfu-Sso7d (rate 15s/kb)
Two-step| 30 cycles | |Breslauer1986,SantaLucia1998
98.0°C |98.0C | |SaltC 50mM
_____ __|_____ | |Primer1C 1000µM
00min30s|10s \ 72.0°C|72.0°C|Primer2C <bound method Amplicon.rc of Amplicon(861)>µM
| \_______|______|
| 0min12s|10min |4-8°C
Carry out a PCR with primers 468, 467 and template pYPKa_A_ScTAL1 resulting in
the PCR product 1097bp_PCR_prod
5GTCGAGGAACGCCAGGTTGCCCACT...TCTGTGCAGACAAACGCATCAGGAT3
||||||||||||||||||||||||| tm 59.0 (dbd) 73.8
3agacacgtctgtttgcgtagtcctaAATTTA5
5gtcgaggaacgccaggttgcccact3
||||||||||||||||||||||||| tm 64.8 (dbd) 79.7
3CAGCTCCTTGCGGTCCAACGGGTGA...AGACACGTCTGTTTGCGTAGTCCTA5
Taq (rate 30 nt/s)
Three-step| 30 cycles | |SantaLucia 1998
94.0°C |94.0°C | |SaltC 50mM
__________|_____ 72.0°C |72.0°C|
04min00s |30s \ ________|______|
| \ 58.0°C/ 0min32s|10min |
| \_____/ | |
| 30s | |4-8°C
Pfu-Sso7d (rate 15s/kb)
Two-step| 30 cycles | |Breslauer1986,SantaLucia1998
98.0°C |98.0C | |SaltC 50mM
_____ __|_____ | |Primer1C 1000µM
00min30s|10s \ 72.0°C|72.0°C|Primer2C <bound method Amplicon.rc of Amplicon(1097)>µM
| \_______|______|
| 0min16s|10min |4-8°C
Carry out a PCR with primers 568, 578 and template pYPKa_E_PDC1tp resulting in
the PCR product 1294bp_PCR_prod
5GTGCCATCTGTGCAGACAAACG...ACTTATGAATGTGGCAATGAGACAAGAAC3
||||||||||||||||||||||||||||| tm 56.5 (dbd) 69.5
3tgaatacttacaccgttactctgttcttg5
5GTGCcatctgtgcagacaaacg3
|||||||||||||||||||||| tm 57.1 (dbd) 71.5
3CACGGTAGACACGTCTGTTTGC...TGAATACTTACACCGTTACTCTGTTCTTG5
Taq (rate 30 nt/s)
Three-step| 30 cycles | |SantaLucia 1998
94.0°C |94.0°C | |SaltC 50mM
__________|_____ 72.0°C |72.0°C|
04min00s |30s \ ________|______|
| \ 55.0°C/ 0min38s|10min |
| \_____/ | |
| 30s | |4-8°C
Pfu-Sso7d (rate 15s/kb)
Two-step| 30 cycles | |Breslauer1986,SantaLucia1998
98.0°C |98.0C | |SaltC 50mM
_____ __|_____ | |Primer1C 1000µM
00min30s|10s \ 72.0°C|72.0°C|Primer2C <bound method Amplicon.rc of Amplicon(1294)>µM
| \_______|______|
| 0min19s|10min |4-8°C
Mix the four linear DNA fragments and transform a Saccharomyces cerevisiae ura3 mutant with the mixture. The fragments will be assembled by in-vivo homologous recombination:
-|pYPKpw|124 | \/ | /\ | 124|861bp_PCR_prod|50 | \/ | /\ | 50|1097bp_PCR_prod|37 | \/ | /\ | 37|1294bp_PCR_prod|242 | \/ | /\ | 242- | | ---------------------------------------------------------------------
PCR using primers 577 & 467
PCR products (bp)
Correct : 1908
Missing first tp : 1265
Missing gene : 898
Missing both : 255
PCR using primers 468 & 578
PCR products (bp)
Correct : 2354
Missing gene : 1344
Missing last tp : 1386
Missing both : 376