Plan for the construction of E. coli vector pYPKa_A_ScXKS1
PCR with primers pfw1803 & prv1803 and template ScXKS1_template results in a 1805bp PCR product
Primers annealing on template:
5ATGTTGTGTTCAGTAATTCA...TGGAAAAGACTCTCATCTAA3
|||||||||||||||||||| tm 45.0 (dbd) 55.7
3ACCTTTTCTGAGAGTAGATT5
5aaATGTTGTGTTCAGTAATTCA3
|||||||||||||||||||| tm 44.8 (dbd) 54.6
3TACAACACAAGTCATTAAGT...ACCTTTTCTGAGAGTAGATT5
Suggested PCR programs for Taq polymerase and for Polymerases with DNA binding domain:
Taq (rate 30 nt/s) 35 cycles |1805bp 95.0°C |95.0°C | |SantaLucia 1998 |_________|_____ 72.0°C |72.0°C|SaltC 50mM | 03min00s|30s \ ________|______| | | \ 52.0°C/ 0min54s| 5min | | | \_____/ | | | | 30s | |4-12°C
Clone the PCR product in pYPKa digested with AjiI resulting in pYPKa_A_ScXKS1
Confirm the structure of the pYPKa_A_ScXKS1 using primers 468, 342 and pfw1803 in a multiplex PCR reaction.
Expected PCR products sizes from 468, 342 and pfw1803 (bp):
pYPKa with insert in correct orientation: 2571, 2521
pYPKa with insert in reverse orientation: 2571, 1855
Empty pYPKa clone : 766