Plan for the construction of E. coli vector pYPKa_A_SsXYL1
PCR with primers pfw957 & prv957 and template SsXYL1_template results in a 959bp PCR product
Primers annealing on template:
5ATGCCTTCTATTAAGTTGAA...AAGATTCCTATCTTCGTCTAA3
||||||||||||||||||||| tm 45.3 (dbd) 55.5
3TTCTAAGGATAGAAGCAGATT5
5aaATGCCTTCTATTAAGTTGAA3
|||||||||||||||||||| tm 43.8 (dbd) 54.9
3TACGGAAGATAATTCAACTT...TTCTAAGGATAGAAGCAGATT5
Suggested PCR programs for Taq polymerase and for Polymerases with DNA binding domain:
Taq (rate 30 nt/s) 35 cycles |959bp 95.0°C |95.0°C | |SantaLucia 1998 |_________|_____ 72.0°C |72.0°C|SaltC 50mM | 03min00s|30s \ ________|______| | | \ 54.0°C/ 0min28s| 5min | | | \_____/ | | | | 30s | |4-12°C
Clone the PCR product in pYPKa digested with AjiI resulting in pYPKa_A_SsXYL1
Confirm the structure of the pYPKa_A_SsXYL1 using primers 468, 342 and pfw957 in a multiplex PCR reaction.
Expected PCR products sizes from 468, 342 and pfw957 (bp):
pYPKa with insert in correct orientation: 1725, 1675
pYPKa with insert in reverse orientation: 1725, 1009
Empty pYPKa clone : 766