Plan for the construction of E. coli vector pYPKa_E_PDC1tp
PCR with primers pfw955 & prv955 and template PDC1_template results in a 968bp PCR product
Primers annealing on template:
5AGGGTAGCCTCCCCAT...ACAGTCAAATCAATCAAA3
|||||||||||||||||| tm 41.1 (dbd) 52.7
3TGTCAGTTTAGTTAGTTTAATTAAT5
5TTAAATAGGGTAGCCTCCCCAT3
|||||||||||||||| tm 49.1 (dbd) 61.3
3TCCCATCGGAGGGGTA...TGTCAGTTTAGTTAGTTT5
Suggested PCR programs for Taq polymerase and for Polymerases with DNA binding domain:
Taq (rate 30 nt/s) 35 cycles |968bp 95.0°C |95.0°C | |SantaLucia 1998 |_________|_____ 72.0°C |72.0°C|SaltC 50mM | 03min00s|30s \ ________|______| | | \ 50.0°C/ 0min29s| 5min | | | \_____/ | | | | 30s | |4-12°C
Clone the PCR product in pYPKa digested with EcoRV resulting in pYPKa_E_PDC1tp
Confirm the structure of the pYPKa_E_PDC1tp using primers 568, 342 and pfw955 in a multiplex PCR reaction.
Expected PCR products sizes from 568, 342 and pfw955 (bp):
pYPKa with insert in correct orientation: 1684, 1653
pYPKa with insert in reverse orientation: 1684, 999
Empty pYPKa clone : 716